Taxus chinensis var. mairei ^{genotypes Baokang} was planted in a research field at Yangtze University and used in this experiment. Cuttings with 16 needles were obtained from these trees in early spring of the year and stored horizontally at 4^oC in a plastic bag until cutting. Cuttings with one stem were prepared and cuttings with similar length and basal end diameter were planted in vermiculite in a planting box and placed in an unheated glasshouse. They were watered with 0.5-liter tap water per planting box every 3 days. Observations on rooting were made at 77 days after planting during each year. All cuttings with roots (>1 mm) were classified as rooted cuttings, and the roots (>1 mm) were used to prepare samples for analysis of antioxidative enzymes and micro RNA expression.

The number of cuttings used for antioxidative enzymes and microRNAs analyses were 756 (NR) and 649 (SR), respectively. The stem portion, needle, roots, and basal portions (2 cm) were collected from the cuttings on the planting day (day 0) and 77 days after planting. Each sample was chopped into small pieces with scissors, immediately frozen in liquid nitrogen, and then stored at −80^oC until analysis. The levels of antioxidative enzymes and microRNAs were measured from samples of the stem portion, needles, roots, and basal portion of cuttings, respectively.

Lipid peroxidation was determined as the amount of thiobarbituric acid reactive substances (TBARS) measured by the thiobarbituric acid (TBA) reaction as described previously 67,68,69. Samples of stem portion, needle, roots, and basal portions (2 cm) of T. chinensis var. mairei cuttings were homogenized in 3 ml of 20 % (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 2,655 g for 20 min and mixed with 20 % TCA containing 0.5 % (w/v) TBA and100 ml 4 % BHT in ethanol at 1:1. After the extracts of plant tissues were heated at 95 ^oC for 30 min, they were cooled on ice for 5 minutes, centrifuged at 10,000 g for 15 min. The absorbance the extracts of different samples was measured at 532 nm. The control of non-specific absorption at 600 nm was subtracted from the samples. The value of TBARS was calculated using the method described previously 26,67,70.

Analysis of phenols was conductedafter harvested the samples. Samples (1 g) of stem portion, needle, roots, and basal portions (2 cm) of T. chinensis var. mairei cuttings were homogenized in 50mL cold 80% methanol using a biomixer (Nihonseiki, Tokyo). Samples were washed twice with 50mL of 80% methanol and filtered. 150mL of distilled water was added to the samples to obtain a crude extract of the phenols.The total phenols content was determined using the Folin-Ciocalteu method 46,71,72,73]. After elimination of methanol in the crude extracts (180 mL) in vacuo, the aqueous phase was diluted five times with distilled water to the final volume of 900 mL. The diluted sample was mixed with 1N Folin-Ciocalteu reagent and then with 10% sodium carbonate 3 min later and placed at room temperature in darkness for 1 h. The absorbance of the reactants at 530 nm was measured. The total concentration of phenolic compounds was estimated by a standard curve obtained with chlorogenic acid (Wako Pure Chemical, Osaka).

Total antioxidant levels were determined from samples (300 mg) of stem portion, needle, roots, and basal portions of T. chinensis var. mairei cuttings using an antioxidant assay kit (Sigma–Aldrich) following the product manual. Antioxidant reactions were performed in a 96-well plate by reading endpoint absorbance at 405 nm using a plate reader (BioTek, Synergy 2, Winooski, VT, USA).

Analysis of PPO, CAT, and POD activity was conducted by following the previous protocol 29,31,32,34,50,57,74,75. Samples (6 g) of stem portion, needle, roots, and basal portions of T. chinensis var. mairei cuttings were immersed in 100mL of cold 80% methanol containing 1mM butylated hydroxytoluene (BHT) and 0.01% ascorbic acid and stirred for 24 h at 4^oC. Activity of antioxidant enzymes PPO was measured by following the modified methods previously described 34. The activity of CAT was determined spectrophotometrically as previously described 51. The decomposition of 1 mmol H₂O₂ per gram FW in 1 min was defined as one unit. The activity of POD was determined according to the procedure 32,51, with a Shimadzu UV-120IV spectrophotometer. The amount of POD catalyzing the oxidation of 1 mol guaiacol in 1 min was defined as one unit. The activities of APOX, GR, and SOD were determined as described previously 39,41,42,43. Two grams of control and sampes of stem portion, needle, roots, and basal portions of T. chinensis var. mairei cuttings were homogenized under ice-cold conditions in 3 ml of extraction buffer, consisting of 50 mM phosphate buffer (pH 7.4), 1 mM EDTA, 1 g PVP, and0.5 % (v/v) Triton X-100 at 4 ^oC. The extracts were centrifuged at 10,000 ´ g for 20 min. The supernatant was used to determine the enzyme activity. APOX activity was measured immediately in fresh extracts and was assayed as described 44. GR activity was determined by following the decrease in absorbance at 340 nm due to NADPH oxidation [42]. SOD activity was measured by the inhibition of the photochemical reduction of NBT, as described 39, 40.

Total RNA was isolated from frozen samples of stem portion, needle, roots, and basal portions of T. chinensis var. mairei cuttings using TRIzol reagent according to the manufacturer’s protocol (Invitrogen). The high quality cDNA were prepared using a TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems). For miRNA expression analysis, TaqMan® MicroRNA Assays (Applied Biosystems) are carried out to amplify RNAs for quantitation of miRNAs. The controls used were as suggested by the manufacturer’s manual. The U6 gene was used as an internal control. Samples were examined in triplicate on the Applied Biosystems 7900HT System, according to the manufacturer’s manual.

For the analysis of microRNAs (miR162, miR408, and miR857) in samples, the extraction procedure was used as previously described 26,27,53,54,55,58, 60,61,68,76. Two specific primers were used to amplify each of miRNAs. Primers used for Real-Time PCR are R1: 5’-AGTGGTTTATCGATCTCTTCCTTG-3’ and F1: 5’-GTGGTTCAAGCGTTTTATTGTTG-3’ for miR162, R2: 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCATGCT-3’ and F2:5’-TCAGCACAGGGAACAAGCAG-3’ for miR408, and R3:5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATACAC-3’ and

F3: 5’-GCGGCGTTTTGTATGTTGAAG-3’ for miR857

Mean values were used to determine the significant differences among different groups with the Least Significant Difference test at 5% level of probability. Statistic analysis of data was performed by Student’s t-test or one-way ANOVA using GraphPad Prism 6 (GraphPad Software Inc., CA).

During the in vitro rooting process in T. chinesis var. mairei, we used two different genotypes of T. chinensis, one with normal rooting and the other with super rooting phenotypes, which originated from sampling at two sites. Cuttings of T. chinensis with normal rooting (NR) are from BaoKang. Cuttings of T. chinensis with super rooting (SR) are from Jingzhou. 3436 cuttings of Baokang were planted at day zero and 756 cuttings of them actually rooted. 832 cuttings of Jingzhou were planted at day zero and 649 cuttings of them actually rooted at 77 days of in vitro rooting. Rooted cuttings (Baokang, 756 plantlets) has low rate of adventitious root formation [named normal rooting (NR) cuttings, Figure 1a], and another type of rooted cuttings (Jinzhou, 649 plantlets) has high rate of adventitious root formation [named super rooting (SR) cuttings, Figure 1b]. To determine the difference of these two types of rooted cuttings, percentage of rooting types (Figure 1c), number of adventitious roots per cuttings (Figure 1d), number of branch per cuttings (Figure 1e), and growth rate (Figure 1f) were measured. Our results demonstrated that percentage of rooting in super rooting cuttings is 3.9 fold higher than in normal rooting cuttings (Figure 1c). There are 3.7 fold increase in number of adventitious roots per cuttings (Figure 1d), 2.1 fold increase in branch number per cuttings (Figure 1e), and 2.6 fold increase in growth rate (Figure 1f) in rooted cuttings with high rate of adventitious root formation, compared to rooted cuttings with low rate of adventitious root formation. Our results indicated that number of adventitious roots (Figure 1d) and number of branch (Figure 1e), as well as growth rate (Figure 1f), are significantly increased in rooted cuttings with high rate of adventitious root formation 77 days after planting.

To evaluate the effect of TBARS, total phenols, and antioxidants content on root formation, TBARS, total phenols, and antioxidants content in different portions of rooted cuttings of T. chinensis var. mairei was determined at 0 and 77 days after planting.TBARS (Figure 2a, Figure 2b, and Figure 2c), total phenols (Figure 2d,Figure 2e, and Figure 2f), and antioxidants content (Figure 2g,Figure 2h, and Figure 2i) was measured from samples of stem portion, basal portion, and needles of rooted cuttings, respectively. Our results demonstrated that TBARS was significantly lower from day 0 to day 77 after planting in stem portion (Figure 2a) and basal portion (Figure 2b) of both NR cuttings and SR cuttings, total phenol was significantly higher from day 0 to day 77 after planting in stem portion (Figure 2d), but was significantly lower from day o to day 77 of planting in basal portion (Figure 2e) of both NR cuttings and SR cuttings. Content of antioxidants significantly increased in base portion (Figure 2h) of SR cuttings, compared to NR cuttings 77 days after planting. TBARS, total phenols, and antioxidants content were not changed in stem portion and needles of two types of cuttings 77 days after planting.

To examine the effect of PPO, CAT, and POD activity on root formation, PPO, CAT, and POD activity in shoot cuttings of T. chinensis var. mairei were measured at 0 and 77 days after planting. PPO (Figure 3a, Figure 3d, Figure 3g, and Figure 3j), CAT (Figure 3b,Figure 3e,Figure 3h, and Figure 3k), and POD activity (Figure 3c,Figure 3f, Figure 3i, and Figure 3l) were examined in stem portion, basal portion, needles, and adventitious roots of rooted cuttings of T. chinensis var. mairei at 0 and 77 days after planting. Our results demonstrated that activity of PPO, CAT, and POD was not changed in stem portion of cuttings between normal rooting and super rooting cuttings (Figure 3a, Figure 3b, Figure 3c). However, activity of PPO, CAT, and POD was significantly higher in basal portion (Figure 3d, Figure 3e, Figure 3f) and adventitious roots (Figure 3j, Figure 3k,Figure 3l) of SR cuttings, compared to NR cuttings 77 days after planting. Activity of PPO and CAT in needles of SR cuttings is similar to that of NR cuttings 77 days after planting (Figure 3g, Figure 3h). Activity of POD significantly increased in needles (Figure 3i) of SR cuttings, compared to NR cuttings 77 days after planting.

To examine the effect of APOX, GR, and SOD activity on root formation, APOX, GR, and SOD activity were measured in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting. APOX (Figure 4a,Figure 4d,Figure 4g, and Figure 4j), GR (Figure 4b, Figure 4e, Figure 4h, and Figure 4k), and SOD activity (Figure 4c, Figure 4f, Figure 4i, and Figure 4l) in stem portion, basal portion, needles, and adventitious roots of rooted cuttings of T. chinensis var. mairei at 0 and 77 days after planting. Our results demonstrated that activity of APOX, GR, and SOD in stem portion (Figure 4a, Figure 4b, Figure 4c) and needles (Figure 4g, Figure 4h, Figure 4i) of SR cuttings were similar to that of NR cuttings. However, activity of APOX, GR, and SOD in adventitious roots was significantly higher in SR cuttings (Figure 4j, Figure 4k, Figure 4l), compared to NR cuttings 77 days after planting. Activity of APOX, GR, and SOD in basal portion (Figure 4d, Figure 4e, Figure 4f) of NR cuttings was higher than SR cuttings before planting (0 day). Activity of APOX, GR, and SOD in basal portion (Figure 4d, Figure 4e, Figure 4f) of NR cuttings with was similar to that of SR cuttings 77 days after planting.

To examine the effect of expression of microRNAs on root formation, expression of microRNAs were measured in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting. MicroRNA162 (Figure 5a, Figure 5d, Figure 5g, and Figure 5j), miR408 (Figure 5b, Figure 5e, Figure 5h, and Figure 5k), and miR857 (Figure 5c, Figure 5f, Figure 5i, and Figure 5l) in stem portion, basal portion, needles, and adventitious roots of rooted cuttings of T. chinensis var. mairei at 0 and 77 days after planting. Our results demonstrated that expression of miR162, miR408, and miR857 was not changed in stem portion (Figure 5a, Figure 5b,Figure 5c) of SR cuttings, compared to NR cuttings. However, expression of miR162, miR408, and miR857 significantly increased in basal portion (Figure 5d, Figure 5e, Figure 5f) of SR cuttings, compared to NR cuttings. Expression of miR162 was not changed in needles (Figure 5g) and roots (Figure 5j), but expression of miR857 significantly increased in needles (Figure 5i) and roots (Figure 5l) of SR cuttings, compared to NR cuttings 77 days after planting. Expression of miR408 was not changed in roots (Figure 5k), but significantly increased in needle (Figure 5h) of SR cuttings, compared to NR cuttings 77 days after planting.